New junction evidence
		seq id	position	reads (cov)	reads (cov)	score	skew	freq	annotation	gene	product
*	?	AP009048	= 3931054	106 (1.810)	4 (0.070)	4/102	NT	4.0%	coding (1115/1692 nt)	eptB	predicted metal dependent hydrolase
	?	AP009048	= 3931080	88 (1.500)					coding (1141/1692 nt)	eptB	predicted metal dependent hydrolase
Rejected: Frequency below/above cutoff threshold.

ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  AP009048/3931000‑3931054 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATTGCTGCATTTCGTCTACCAGCA  <  AP009048/3931080‑3931057                                                                                 ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATGTTGCTGCATTTCGTC          >  1:5341332/1‑71       AGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATATTGCTGCATTTCGTCTACCA     <  1:4745831/70‑1        GCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATGTTGCTGCATTTCGTCTACCAGC   <  1:4458671/71‑1          AGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATATATTGCTGCATTTCGTCTACCAGCA  <  1:3191925/70‑1                                                                                 ATCGTGAGCAGATTGGTGCGGAGCCACGTAATCGTGGCAAGCCGGTAGATGATAT‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑  >  AP009048/3931000‑3931054 ‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑ATTGCTGCATTTCGTCTACCAGCA  <  AP009048/3931080‑3931057

Alignment Legend
Aligned base mismatch/match (shaded by quality score): ATCG/ATCG < 3 ≤ ATCG/ATCG < 32 ≤ ATCG/ATCG < 36 ≤ ATCG/ATCG
Unaligned base: atcg    Masked matching base: atcg    Alignment gap: ‑    Deleted base: ‑
Reads not counted as support for junction
read_name Not counted due to insufficient overlap past the breakpoint.
read_name Not counted due to not crossing MOB target site duplication.