mutation predictions | marginal predictions | summary statistics | genome diff | command line log
|
breseq version 0.35.4 revision f352f80f4bc9
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | ||||||
|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | annotation | gene | description |
| RA | CP009273 | 1,543 | G→A | G403S (GGT→AGT) | thrA → | Bifunctional aspartokinase/homoserine dehydrogenase 1 |
| RA | CP009273 | 164,770 | +G | coding (800/2244 nt) | fhuA → | ferrichrome outer membrane transporter |
| JC | CP009273 | 415,065 | (AAGAT)1→2 | coding (19/1320 nt) | brnQ → | branched‑chain amino acid transport system 2 carrier protein; LIV‑II transport system for Ile, Leu, and Val |
| JC | CP009273 | 1,013,537 | (TTGGCA)1→2 | coding (219/1761 nt) | ycbZ ← | putative peptidase |
| MC JC | CP009273 | 1,106,933 | Δ3,772 bp | [opgH]–[mdtG] | [opgH], yceK, msyB, [mdtG] | |
| JC | CP009273 | 1,257,022 | (AGTGATTGGTACACGAGC)1→2 | coding (310/948 nt) | prs ← | phosphoribosylpyrophosphate synthase |
| RA | CP009273 | 1,325,806 | C→T | R168C (CGT→TGT) | topA → | DNA topoisomerase I, omega subunit |
| MC JC | CP009273 | 2,400,028 | Δ9 bp | coding (85‑93/939 nt) | lrhA ← | transcriptional repressor of flagellar, motility and chemotaxis genes |
| RA | CP009273 | 2,528,814 | G→A | D464N (GAC→AAC) | ptsI → | PEP‑protein phosphotransferase of PTS system (enzyme I) |
| RA | CP009273 | 2,727,902 | (C)8→9 | coding (492/732 nt) | yfiH ← | UPF0124 family protein |
| MC JC | CP009273 | 2,961,766 | Δ5 bp | coding (24‑28/2247 nt) | ptsP ← | fused PTS enzyme: PEP‑protein phosphotransferase (enzyme I)/GAF domain containing protein |
| RA | CP009273 | 3,464,372 | +A | coding (317/1185 nt) | tufA ← | translation elongation factor EF‑Tu 1 |
| JC | CP009273 | 3,479,546 | +TAA | coding (68/633 nt) | crp → | cAMP‑activated global transcription factor, mediator of catabolite repression |
| RA | CP009273 | 4,151,176 | T→G | V42G (GTC→GGC) | fabR → | transcriptional repressor of fabA and fabB |
| RA | CP009273 | 4,154,051 | G→C | G162A (GGA→GCA) | btuB → | vitamin B12/cobalamin outer membrane transporter |
| RA | CP009273 | 4,231,705 | G→T | R160S (CGC→AGC) | xylE ← | D‑xylose transporter |
| JC | CP009273 | 4,236,389 | (CACCTA)1→2 | intergenic (‑42/‑323) | malE ← / → malK | maltose transporter subunit/fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein |
| JC | CP009273 | 4,237,722 | (CCGCCAGAACGACGTGGTGTTGGTA)1→2 | coding (1011/1116 nt) | malK → | fused maltose transport subunit, ATP‑binding component of ABC superfamily/regulatory protein |
| JC | CP009273 | 4,469,423 | (TCTTCTTACGTACGCAAGC)1→2 | intergenic (‑69/‑124) | yjgM ← / → yjgN | putative acetyltransferase/DUF898 family inner membrane protein |
| MC JC | CP009273 | 4,581,222 | Δ3 bp | intergenic (‑126/‑250) | yjiY ← / → tsr | putative transporter/methyl‑accepting chemotaxis protein I, serine sensor receptor |
| RA | CP009273 | 4,618,035 | G→A | A302T (GCC→ACC) | nadR → | trifunctional protein: nicotinamide mononucleotide adenylyltransferase, ribosylnicotinamide kinase, transcriptional repressor |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | CP009273 | 782247 | 783091 | 845 | 91 [88] | [89] 94 | gpmA | gpmA |
| * | * | ÷ | CP009273 | 1800590 | 1801571 | 982 | 93 [90] | [88] 92 | pfkB | pfkB |
| * | * | ÷ | CP009273 | 1929079 | 1930616 | 1538 | 91 [90] | [90] 94 | zwf | zwf |
| * | * | ÷ | CP009273 | 3778568 | 3780196 | 1629 | 94 [90] | [89] 91 | gpmM | gpmM |
| * | * | ÷ | CP009273 | 4097438 | 4098465 | 1028 | 91 [87] | [87] 93 | pfkA | pfkA |
| * | * | ÷ | CP009273 | 4205381 | 4210251 | 4871 | 94 [90] | [90] 92 | aceB–[arpA] | aceB,aceA,[aceK],[arpA] |
| Unassigned new junction evidence | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | CP009273 | 119144 = | 21 (0.130) | 156 (0.940) | 112/200 | 0.2 | 88.1% | coding (566/765 nt) | pdhR | pyruvate dehydrogenase complex repressor; autorepressor |
| ? | CP009273 | = 119152 | NA (NA) | coding (574/765 nt) | pdhR | pyruvate dehydrogenase complex repressor; autorepressor | |||||
| * | ? | CP009273 | 189030 = | 23 (0.140) | 171 (1.030) | 110/200 | 0.2 | 88.1% | coding (689/726 nt) | pyrH | uridylate kinase |
| ? | CP009273 | = 189041 | NA (NA) | coding (700/726 nt) | pyrH | uridylate kinase | |||||
| * | ? | CP009273 | 1662553 = | 7 (0.040) | 190 (1.150) | 118/200 | 0.1 | 96.5% | coding (269/1221 nt) | mlc | glucosamine anaerobic growth regulon transcriptional repressor; autorepressor |
| ? | CP009273 | = 1662559 | NA (NA) | coding (263/1221 nt) | mlc | glucosamine anaerobic growth regulon transcriptional repressor; autorepressor | |||||
| * | ? | CP009273 | 2006970 = | 55 (0.330) | 142 (0.870) | 106/198 | 0.3 | 74.5% | coding (261/1659 nt) | fliF | flagellar basal‑body MS‑ring and collar protein |
| ? | CP009273 | = 2007005 | 43 (0.260) | coding (296/1659 nt) | fliF | flagellar basal‑body MS‑ring and collar protein | |||||
| * | ? | CP009273 | 2278943 = | 16 (0.100) | 152 (0.920) | 100/200 | 0.6 | 90.5% | coding (1089/1761 nt) | yejM | essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor |
| ? | CP009273 | = 2278953 | NA (NA) | coding (1099/1761 nt) | yejM | essential inner membrane DUF3413 domain‑containing protein; lipid A production and membrane permeability factor | |||||
| * | ? | CP009273 | 3728756 = | 83 (0.500) | 177 (1.070) | 116/200 | 0.1 | 71.4% | coding (418/1179 nt) | xylR | xylose divergent operon transcriptional activator |
| ? | CP009273 | = 3728788 | 59 (0.360) | coding (450/1179 nt) | xylR | xylose divergent operon transcriptional activator | |||||